Introduction of pseudovirus nCoV-E
The E gene sequence of COVID (2019-ncov, reference sequence is NC_045512) was synthesized, cloned and constructed into lentivirus vector, and pseudovirus was prepared in 293T cells. The obtained pseudovirus is an RNA sequence containing 228 base of E gene in lentivirus genome. It can be used as a reference for virus RNA extraction experiment and qPCR detection experiment.
Sequence information of pseudovirus nCoV-E
atgtactcattcgtttcggaagagacaggtacgttaatagttaatagcgtacttctttttcttgctttcgtggtattcttgctagtta cactagccatccttactgcgcttcgattgtgtgcgtactgctgcaatattgttaacgtgagtcttgtaaaaccttctttttacgttta ctctcgtgttaaaaatctgaattcttctagagttcctgatcttctggtctaa
Product specification
1ml / branch, inactivated, in which nCoV-E RNA concentration is not less than 1E8 copies / ml.
Storage conditions and validity
Frozen under - 40 ℃, valid for 12 months.
Usage method
(1)Pseudovirus melting:Take the pseudovirus out of the refrigerator and melt it on ice or at 4 ℃ naturally. After it melts completely, carry out relevant experimental operations.
(2)Extraction of pseudovirus nucleic acid(Material self provided):This product can be used for extraction of pseudovirus RNA by membrane adsorption or magnetic bead adsorption kit.
(3)QPCR detection:QPCR quantitative test was carried out after pseudoviral RNA was transformed into cDNA by RT-PCR.
Note
(1)Freezing and thawing will reduce the stability of pseudovirus, thus affecting the effect of nucleic acid extraction and qPCR test results. Repeated freezing and thawing should be avoided when using.
(2)Virus inactivation may lead to RNA degradation. Please choose a reasonable way according to the actual experimental needs.
(3)If the product needs to be diluted, it can be diluted with PBS.
(4)Recommended dosage: 50 μ L-100 μ L / time. It is suggested that each laboratory should make optimization and adjustment according to the experimental situation.
Quality inspection standard
(1)RNA concentration of pseudovirus ncov-E is not less than 1E8 copies / ml.
(2)The residual amount of nCoV-E plasmid is no more than 3% of the amount of nCoV-E RNA.(nCoV-E standard plasmid and nCoV-E standard RNA were used for absolute quantification)
Lentivirus skeleton vector is PDS085_pL-MCS(Cleavage site: NheI / AscI in MCS region)
Note
At present, the company's pseudovirus is used as a positive control for quality control, and it is an inactivated virus product, mainly used for testing enterprise users.
We are still in the process of internal research and development of pseudoviruses that are used to simulate the infection of viruses for subsequent cell function experiments.
Related reading:
COVID-19 Related Products Collection
Lentivirus Packaging Services
Pseudovirus Products